ID: 1011996745_1011996750

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1011996745 1011996750
Species Human (GRCh38) Human (GRCh38)
Location 6:93599313-93599335 6:93599332-93599354
Sequence CCACCCATATTTCATGTTGAAAT AAATTTCCAGTGTTGGAGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!