ID: 1012044160_1012044167

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1012044160 1012044167
Species Human (GRCh38) Human (GRCh38)
Location 6:94248313-94248335 6:94248336-94248358
Sequence CCAAATTTCCTCTTCATATAAGG GTACCAGTCGTTTGGGATTAGGG
Strand - +
Off-target summary {0: 4, 1: 92, 2: 401, 3: 895, 4: 1435} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!