ID: 1012119007_1012119014

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1012119007 1012119014
Species Human (GRCh38) Human (GRCh38)
Location 6:95340059-95340081 6:95340098-95340120
Sequence CCTCTAGATTTGCCTATGTGTAG CTGCATCATAGTCTTTGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!