ID: 1012172659_1012172664

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1012172659 1012172664
Species Human (GRCh38) Human (GRCh38)
Location 6:96038606-96038628 6:96038639-96038661
Sequence CCAATATGTTTCCCACCAGCTGC TTTAAAATGCAAATCTGACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 167} {0: 1, 1: 1, 2: 15, 3: 121, 4: 754}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!