ID: 1012272181_1012272182

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1012272181 1012272182
Species Human (GRCh38) Human (GRCh38)
Location 6:97226964-97226986 6:97226987-97227009
Sequence CCAGTTGAGAACTACTGAACTAG AGAATGAAGAAGTGAAGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 28, 3: 191, 4: 588} {0: 1, 1: 0, 2: 2, 3: 53, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!