ID: 1012294321_1012294323

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1012294321 1012294323
Species Human (GRCh38) Human (GRCh38)
Location 6:97501627-97501649 6:97501680-97501702
Sequence CCATATTCAGGAGTGAGGTATGA CCATTTATCAAACACCGACCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!