ID: 1012326607_1012326613

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1012326607 1012326613
Species Human (GRCh38) Human (GRCh38)
Location 6:97927483-97927505 6:97927515-97927537
Sequence CCCACCTCTTAATACTATCATCT AGTTTCATCATATGAATTTTGGG
Strand - +
Off-target summary No data {0: 2, 1: 67, 2: 454, 3: 1650, 4: 3583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!