ID: 1012373774_1012373786

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1012373774 1012373786
Species Human (GRCh38) Human (GRCh38)
Location 6:98537122-98537144 6:98537170-98537192
Sequence CCTGTAATCCCAGCTACTTGGGA CCTGGGAGGCAGAAGTTGCAGGG
Strand - +
Off-target summary {0: 48553, 1: 142115, 2: 242012, 3: 520212, 4: 384467} {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!