ID: 1012373778_1012373786

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1012373778 1012373786
Species Human (GRCh38) Human (GRCh38)
Location 6:98537131-98537153 6:98537170-98537192
Sequence CCAGCTACTTGGGAGGCTGAGGG CCTGGGAGGCAGAAGTTGCAGGG
Strand - +
Off-target summary {0: 990, 1: 97260, 2: 209019, 3: 250859, 4: 263158} {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!