ID: 1012413236_1012413242

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1012413236 1012413242
Species Human (GRCh38) Human (GRCh38)
Location 6:98984174-98984196 6:98984200-98984222
Sequence CCAGATTCAAATATTGAAGCCCT CCCCAGTGTATTTGGAGATAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!