ID: 1012413239_1012413248

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1012413239 1012413248
Species Human (GRCh38) Human (GRCh38)
Location 6:98984194-98984216 6:98984230-98984252
Sequence CCTAAGCCCCAGTGTATTTGGAG AAGGTAGTTAATATTAAATGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 162} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!