ID: 1012465640_1012465644

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1012465640 1012465644
Species Human (GRCh38) Human (GRCh38)
Location 6:99514279-99514301 6:99514297-99514319
Sequence CCTTCCTCCATCAGTGAAAATGC AATGCAGCAGTTTCCGCGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!