ID: 1012475724_1012475729

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1012475724 1012475729
Species Human (GRCh38) Human (GRCh38)
Location 6:99613565-99613587 6:99613581-99613603
Sequence CCCCTACCGGGAGGAGAGCAGCA AGCAGCAGCAAGCAAGGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 236} {0: 1, 1: 0, 2: 8, 3: 48, 4: 566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!