ID: 1012519665_1012519670

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1012519665 1012519670
Species Human (GRCh38) Human (GRCh38)
Location 6:100106102-100106124 6:100106128-100106150
Sequence CCTGGGTGATGATGTTGACTTTC GAGTCCAGGCACACCACGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!