ID: 1012519671_1012519680

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1012519671 1012519680
Species Human (GRCh38) Human (GRCh38)
Location 6:100106132-100106154 6:100106160-100106182
Sequence CCAGGCACACCACGTGGGGCCAC GAAGCAACCAGGGTTAGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!