|
Left Crispr |
Right Crispr |
| Crispr ID |
1012546792 |
1012546798 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:100428982-100429004
|
6:100428997-100429019
|
| Sequence |
CCACAGAAAGCAAAACTGTGGAT |
CTGTGGATAAGGGGGGACTATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 15, 1: 21, 2: 81, 3: 188, 4: 502} |
{0: 2, 1: 1, 2: 10, 3: 30, 4: 137} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|