ID: 1012598442_1012598454

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1012598442 1012598454
Species Human (GRCh38) Human (GRCh38)
Location 6:101066707-101066729 6:101066750-101066772
Sequence CCGCAGAGCAGGGGGTGGCACCT ACAAGAGCCTACCGTTGGGGGGG
Strand - +
Off-target summary {0: 3, 1: 5, 2: 15, 3: 78, 4: 476} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!