ID: 1012616364_1012616376

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1012616364 1012616376
Species Human (GRCh38) Human (GRCh38)
Location 6:101283787-101283809 6:101283838-101283860
Sequence CCAGCCACCCCCACCAGTGTTCT GAGACTGAGCTCCCAGAGGGAGG
Strand - +
Off-target summary {0: 14, 1: 29, 2: 65, 3: 147, 4: 456} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!