ID: 1012625478_1012625485

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1012625478 1012625485
Species Human (GRCh38) Human (GRCh38)
Location 6:101399634-101399656 6:101399686-101399708
Sequence CCACAGTAGCTTGCCACGGAGAT CCACTCCCGCCTGTCTCCCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 37, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!