ID: 1012625870_1012625875

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1012625870 1012625875
Species Human (GRCh38) Human (GRCh38)
Location 6:101402617-101402639 6:101402633-101402655
Sequence CCTTTGATCCTGTGTTGGGACAA GGGACAACTTGGGTTTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112} {0: 1, 1: 0, 2: 0, 3: 3, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!