ID: 1012627818_1012627820

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1012627818 1012627820
Species Human (GRCh38) Human (GRCh38)
Location 6:101425845-101425867 6:101425864-101425886
Sequence CCTGTCTTCTGAGCATCAGTTTT TTTTCCTCTCCAGGATTTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 32, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!