ID: 1012630828_1012630833

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1012630828 1012630833
Species Human (GRCh38) Human (GRCh38)
Location 6:101464896-101464918 6:101464945-101464967
Sequence CCTGGCAGAGACTAAGTATATGG TCTAAGTCAATCTTGATAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134} {0: 1, 1: 0, 2: 0, 3: 10, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!