ID: 1012659965_1012659967

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1012659965 1012659967
Species Human (GRCh38) Human (GRCh38)
Location 6:101875438-101875460 6:101875479-101875501
Sequence CCATCATATATCTGCTCAGCCAA ATGTTACAGTGCAATTGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 138} {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!