ID: 1012680081_1012680086

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1012680081 1012680086
Species Human (GRCh38) Human (GRCh38)
Location 6:102169220-102169242 6:102169259-102169281
Sequence CCAAACACAGCATGTTCTCACTC CAGTGAAAACACAGGGACACAGG
Strand - +
Off-target summary No data {0: 1, 1: 40, 2: 1331, 3: 16735, 4: 17554}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!