ID: 1012709671_1012709678

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1012709671 1012709678
Species Human (GRCh38) Human (GRCh38)
Location 6:102582753-102582775 6:102582799-102582821
Sequence CCTTGCAGACCTTGCACTCCTTG GCGCCTGGCTCGCTATTGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 54, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!