ID: 1012730461_1012730465

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1012730461 1012730465
Species Human (GRCh38) Human (GRCh38)
Location 6:102874319-102874341 6:102874339-102874361
Sequence CCTTTTGAGAGACAGCTCTTGGC GGCCTGTTACTGGGTTTTGGTGG
Strand - +
Off-target summary {0: 173, 1: 182, 2: 165, 3: 95, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!