ID: 1012745532_1012745537

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1012745532 1012745537
Species Human (GRCh38) Human (GRCh38)
Location 6:103082484-103082506 6:103082525-103082547
Sequence CCTTTTCCATCTATAAATACTGT GGAGCTCTCTGAACTTTTACTGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 18, 3: 48, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!