ID: 1012769116_1012769126

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1012769116 1012769126
Species Human (GRCh38) Human (GRCh38)
Location 6:103405698-103405720 6:103405743-103405765
Sequence CCATGAGTCTGACCCTTCCCTCT GGGCAAACTTGAACTGCAAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!