ID: 1012774051_1012774055

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1012774051 1012774055
Species Human (GRCh38) Human (GRCh38)
Location 6:103480311-103480333 6:103480329-103480351
Sequence CCTCTCTGTGATATTGGTTATAA TATAATATCCAGAAGGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 25, 4: 512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!