ID: 1012820799_1012820805

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1012820799 1012820805
Species Human (GRCh38) Human (GRCh38)
Location 6:104082889-104082911 6:104082928-104082950
Sequence CCCGGCCATCTTCTGCAGATAAC AACAGTTCTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 1, 1: 185, 2: 173, 3: 142, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!