ID: 1012821006_1012821013

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1012821006 1012821013
Species Human (GRCh38) Human (GRCh38)
Location 6:104084423-104084445 6:104084450-104084472
Sequence CCCCTACCTTAAATCAACAGGCT AGGGAGTTACAGTGTTGACTGGG
Strand - +
Off-target summary No data {0: 14, 1: 171, 2: 228, 3: 164, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!