ID: 1012826001_1012826006

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1012826001 1012826006
Species Human (GRCh38) Human (GRCh38)
Location 6:104147666-104147688 6:104147707-104147729
Sequence CCAATTACTAAATAAAATCTGTT AAGTAGTTAAGGAGCTGAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!