ID: 1012931419_1012931422

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1012931419 1012931422
Species Human (GRCh38) Human (GRCh38)
Location 6:105321433-105321455 6:105321452-105321474
Sequence CCGAAGCGCATGTTCTCCACGGT CGGTTTAACCTGGACATTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} {0: 1, 1: 0, 2: 1, 3: 2, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!