ID: 1012931951_1012931957

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1012931951 1012931957
Species Human (GRCh38) Human (GRCh38)
Location 6:105326741-105326763 6:105326785-105326807
Sequence CCGGAAGCCCCATTCTCTGGTTT CAGAGAAAAGAGAAAAATGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 14, 3: 162, 4: 1611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!