ID: 1012937497_1012937502

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1012937497 1012937502
Species Human (GRCh38) Human (GRCh38)
Location 6:105383543-105383565 6:105383563-105383585
Sequence CCATCTCTTCTCTCTGGGACCAT CATCTGCTCTTGGGTGAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 461} {0: 1, 1: 0, 2: 2, 3: 15, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!