ID: 1012960482_1012960484

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1012960482 1012960484
Species Human (GRCh38) Human (GRCh38)
Location 6:105616661-105616683 6:105616679-105616701
Sequence CCTCATTCCATCTGTGGGGACAG GACAGCCCACTGTTTGCACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!