ID: 1012998221_1012998228

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1012998221 1012998228
Species Human (GRCh38) Human (GRCh38)
Location 6:105994239-105994261 6:105994258-105994280
Sequence CCGCCTAAAGAGGCCCGGGCTCT CTCTCCCCCGGGGTCGTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85} {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-4 6:105994239-105994261 CCGCCTAAAGAGGCCCGGGCTCT - 6:105994258-105994280 CTCTCCCCCGGGGTCGTTGTTGG +