ID: 1013036078_1013036079

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1013036078 1013036079
Species Human (GRCh38) Human (GRCh38)
Location 6:106384557-106384579 6:106384590-106384612
Sequence CCGTAATCTCATTTTGCTTGCAG AAACCCTGCTTCACAAAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 37, 4: 413} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!