ID: 1013055784_1013055786

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1013055784 1013055786
Species Human (GRCh38) Human (GRCh38)
Location 6:106581587-106581609 6:106581604-106581626
Sequence CCAAACAGCTTGTGCAGGAGAGG GAGAGGAGAATCAAAGCACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 37, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!