ID: 1013106118_1013106125

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1013106118 1013106125
Species Human (GRCh38) Human (GRCh38)
Location 6:107028094-107028116 6:107028121-107028143
Sequence CCTCCAAGACGCGGCCTCCAGCA TCGCTGCTTCGCTGCCGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140} {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!