ID: 1013120388_1013120391

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1013120388 1013120391
Species Human (GRCh38) Human (GRCh38)
Location 6:107135572-107135594 6:107135600-107135622
Sequence CCGAAAGTGCTGGGATTACAGGC CCACCATGCCCGGCTAAAACAGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 48, 3: 409, 4: 1703}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!