ID: 1013146483_1013146490

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1013146483 1013146490
Species Human (GRCh38) Human (GRCh38)
Location 6:107399230-107399252 6:107399267-107399289
Sequence CCCTTAGCCTCTAACAAGGTACC TCTACCACACATTTTCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 51} {0: 1, 1: 0, 2: 1, 3: 11, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!