ID: 1013152563_1013152572

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1013152563 1013152572
Species Human (GRCh38) Human (GRCh38)
Location 6:107460014-107460036 6:107460052-107460074
Sequence CCACGTCTCAGTGGTGGAACGCC GCTGAGCCCTCGTGTCCTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!