ID: 1013170790_1013170801

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1013170790 1013170801
Species Human (GRCh38) Human (GRCh38)
Location 6:107634941-107634963 6:107634959-107634981
Sequence CCCGCCCGCCGCCGGCGACCCAG CCCAGGCCCGGGCGCCCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 265} {0: 1, 1: 0, 2: 7, 3: 39, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!