ID: 1013175857_1013175859

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1013175857 1013175859
Species Human (GRCh38) Human (GRCh38)
Location 6:107675812-107675834 6:107675827-107675849
Sequence CCACACAAAGCAATGATGTAGGA ATGTAGGAGGTGTATGAAGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!