ID: 1013191756_1013191761

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1013191756 1013191761
Species Human (GRCh38) Human (GRCh38)
Location 6:107809704-107809726 6:107809730-107809752
Sequence CCAGTTTTGGAAACGTTGAGTTC ATGCCTGTGGAACAGGTAGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!