ID: 1013225943_1013225956

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1013225943 1013225956
Species Human (GRCh38) Human (GRCh38)
Location 6:108119474-108119496 6:108119503-108119525
Sequence CCCCAGCGCAGGCGTGGCAGGGC CACCGAGGAAGGCGTGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 233} {0: 1, 1: 0, 2: 2, 3: 28, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!