ID: 1013251841_1013251847

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1013251841 1013251847
Species Human (GRCh38) Human (GRCh38)
Location 6:108342171-108342193 6:108342188-108342210
Sequence CCCATCCCTTTCTATGCCCTCTG CCTCTGTCCTGTTTCCTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 375} {0: 1, 1: 0, 2: 6, 3: 37, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!