ID: 1013251843_1013251850

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1013251843 1013251850
Species Human (GRCh38) Human (GRCh38)
Location 6:108342176-108342198 6:108342203-108342225
Sequence CCCTTTCTATGCCCTCTGTCCTG CTGCAAGGAATGCCTCCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 410} {0: 1, 1: 0, 2: 0, 3: 31, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!