ID: 1013277510_1013277519

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1013277510 1013277519
Species Human (GRCh38) Human (GRCh38)
Location 6:108599967-108599989 6:108600020-108600042
Sequence CCTCTATGTGAGAAGATCTGAGG TTTTATATGTATAAGGAGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 23, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!